                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.00 kcal/mol
Antiterminator:    Distance from promoter:87 nt. Size=37 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:76 nt.    Size=27 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAA-TAAAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAAAGTTTGTTTCTGAGCGCGGTAAAATTTTACCACGTCGTGTAACTGGAACAAA
CGCTAAATACCAACGTAAATTGACTGCAGCGATCAAACGCGCACGTCAAATGGCTTTA
CTTCCATACGTAAGCGGTGAGTAAgctgatatgtaaagagcaaggaccttcgggttcttgctcttttttataggggggagga
tgaaacATG

    exoA --- ccpB --- yyaH --- maa Gene: exoA     GI: 16081140     BI number: BSU40880     GOG: COG0708     Description: - Gene: ccpB     GI: 16081139     BI number: BSU40870     GOG: COG1609     Description: putative transcriptional regulator (LacI family) Gene: yyaH     GI: 16081138     BI number: BSU40860     GOG: COG0346     Description: - Gene: maa     GI: 16081137     BI number: BSU40850     GOG: COG0110     Description: maltose O-acetyltransferas            GT           A  A           G  A            Tg            Gc        tc CA        Gt       t  g C  T       Cg        cg T  A      G  a       cg T  C      A  |       at CG        At        gt AT        Ta        gc T  |       Gt        at TA        Cg        at TA        At        cg CG        Ta        gc GC       A  a       at G  G      C  a       gc TG        Cg        at AT        Ta        at                         ttttataggggggaggatgaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0708 Exonuclease III ... can be seen here [K] COG1609 Transcriptional regulators ... can be seen here [E] COG0346 Lactoylglutathione lyase and related lyases ... can be seen here [R] COG0110 Acetyltransferase (isoleucine patch superfamily) ... can be seen here     ..................................................................................................................