                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGACCTCGCGTTTTCCGGCTGTGCACGGAGGGCCGATCCATATTGGCAATCCGGGAGC
AATCGGGATTCGCGATCTCGGGAAACCGGATTTCGGAGATGCCGTTTCCATTCGTGAC
GGCGAGGTTCCTGTTTTTTGGGCATGCGGAGTGACCCCGCAAGCCGTGGCTATGAATG
TAAAGCCTGAAATGGTCATCACACATGCGCCGGGGCATATGCTCATCACAGATATTCG
AGACGAGTCGCTTGCGGTGCTGTAGcctctcgtcatcctgatgaacgagaattaaagaggtgagaaagATG

    kipI --- kipA --- kipR Gene: kipI     GI: 50812186     BI number: BSU04080     GOG: COG2049     Description: - Gene: kipA     GI: 50812187     BI number: BSU04090     GOG: COG1984     Description: - Gene: kipR     GI: 16077477     BI number: BSU04100     GOG: COG1414     Description: transcriptional regulator (IclR family AA G  A GC GC         T CG       A  T T  |      C  C CG       C  G TA       T  T AT        TG GT        TA C  T       GC GC        CG CG        CG TG        GC TA        TG |  G      |  A |  A      |  G A  T      A  G G  G       GT GC        AT GC        GC CG        GC             TGTTTTTTGGGCATGCGGAGTGACCCCGCAAGCCGTGGCTATGAATGTAAAGCCTGAAATGGTCATCACACATGCGCCGGGGCATATGCTCATCACAGATATTCGAGACGAGTCGCTTGCGGTGCTGTAGcctctcgtcatcctgatgaacgagaattaaagaggtgagaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2049 Allophanate hydrolase subunit 1 ... can be seen here [E] COG1984 Allophanate hydrolase subunit 2 ... can be seen here [K] COG1414 Transcriptional regulator ... can be seen here     ..................................................................................................................