                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:37 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-15.70 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=43 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:34 nt.    Size=46 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaag-tacact. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggaagattcattcataatgtggtacactcatcaacggaaacgaatcaattaaatagctattatcacttgtataacctcaataatatggtttgagggtgt
ctaccaggaaccgtaaaatcctgattacaaaatttgtttatgacattttttgtaatcaggattttttttatttatcaaaacatttaagtaaaggagtttg
ttATG

    ydhL Gene: ydhL     GI: 50812189     BI number: BSU05800     GOG: -------     Description:   a t  t a  g        t a  g      g  a t  t      c  a at       c  a        a at       a  a      t  t cg        at        tg ta        gc        ta cg        gc        gc cg        at        ta |  g       cg       t  t |  t      c  a      t  t a  g      a  t       at a  t      t  t       at t  c      c  |       at at        ta        at ta        gc        cg gc        ta        at t  c      |  a       ta ta       g  a       ta cg       g  a       at a  |       gt        gc cg        at        ta ta        gt        cg                         gattttttttatttatcaaaacatttaagtaaaggagtttgttATG                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................