                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-11.64 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTTTCTTTAAGAATGAAGAATTAGTATCATATCAGCAGCTTATGGCAGGCTGGATC
TATTAAtcattgtgaaaataagcaacagagccggcaacatataacgccgccggtttttgttctgttttgtaaaggtttacattaaagtgaataaag
ggttgaatggcagtgtgcatcagacctctgcctttcccaacgatctaaaatcagctgaaaagctgatttttttattgaaacaatacaatttcctgataaa
acaagctatactaggacaaaaagacagcgagactgggagagtagagATG

    cheR Gene: cheR     GI: 50812262     BI number: BSU22720     GOG: COG1352     Description: methyl-accepting chemotaxis proteins (MCPs) methyltransferas             t           a  c           c  a           g  g            ta ta        gc t  a      |  c a  a      t  t cg        gc at        at tg        cg ta        gc ta        gc gt       t  t |  a       at |  a       at |  a       gc |  g      |  c g  g      |  c a  g      |  a at       |  a at       |  c tg        tg g  a       ta t  a       gt t  t       gc        aa tg        gt       g  a tg       a  a       ta gc       a  a       cg ta       a  a       gc cg       t  a       at |  t      a  t       cg |  g      a  c       ta t  t      g  a       at tg        tg        at gc        gc        at ta        at        at                         tttattgaaacaatacaatttcctgataaaacaagctatactaggacaaaaagacagcgagactgggagagtagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG1352 Methylase of chemotaxis methyl-accepting proteins ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:172 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-12.12 kcal/mol Antiterminator: Size=43 nt.     Delta G= -9.62 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -8.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATTTTCTTTAAGAATGAAGAATTAGTATCATATCAGCAGCTTATGGCAGGCTGGATC TATTAAtcattgtgaaaataagcaacagagccggcaacatataacgccgccggtttttgttctgttttgtaaaggtttacattaaagtgaataaag ggttgaatggcagtgtgcatcagacctctgcctttcccaacgatctaaaatcagctgaaaagctgatttttttattgaaacaatacaatttcctgataaa acaagctatactaggacaaaaagacagcgagactgggagagtagagATG     cheR Gene: cheR     GI: 50812262     BI number: BSU22720     GOG: COG1352     Description: methyl-accepting chemotaxis proteins (MCPs) methyltransferas   A T  T       aa T  G      g  a CG        ta GC        gt |  A       ta         t A  G       ta       a  a CG       a  g      t  a GC       c  c      a  c AT       t  a      c  g CG       A  a      a  c TG       A  c      a  c A  A      T  |       cg T  T      T  |       gc A  C      A  |       gc C  |       Ta        cg T  |       Cg        cg AT        Ta       |  t TA       A  g       gt GT        Gc        at AT        Gc        gt TA        Tg        at TA        Cg        cg At        Gc        at                         tctgttttgtaaaggtttacattaaagtgaataaagggttgaatggcagtgtgcatcagacctctgcctttcccaacgatctaaaatcagctgaaaagctgatttttttattgaaacaatacaatttcctgataaaacaagctatactaggacaaaaagacagcgagactgggagagtagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG1352 Methylase of chemotaxis methyl-accepting proteins ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.72 kcal/mol Antiterminator: Size=43 nt.     Delta G= -9.62 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-10.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATTTTCTTTAAGAATGAAGAATTAGTATCATATCAGCAGCTTATGGCAGGCTGGATC TATTAAtcattgtgaaaataagcaacagagccggcaacatataacgccgccggtttttgttctgttttgtaaaggtttacattaaagtgaataaag ggttgaatggcagtgtgcatcagacctctgcctttcccaacgatctaaaatcagctgaaaagctgatttttttattgaaacaatacaatttcctgataaa acaagctatactaggacaaaaagacagcgagactgggagagtagagATG     cheR Gene: cheR     GI: 50812262     BI number: BSU22720     GOG: COG1352     Description: methyl-accepting chemotaxis proteins (MCPs) methyltransferas   A T  T T  G CG GC |  A A  G CG GC AT        gt CG       t  g T  |       ta A  |       aa T  |       ca A  |       ta CG       A  t TA       A  a AT       T  a T  |      T  g        t GC       A  c      a  a AT       T  |      t  a T  |      C  |      a  c TA       T  |      c  g AT        Aa       a  c AT        Ga       a  c G  A       Gc        cg A  A      T  a       gc At        Cg        gc Gc        Ga        cg Ta        Gg        cg At        Ac        gt At        Cc        at                         tttgttctgttttgtaaaggtttacattaaagtgaataaagggttgaatggcagtgtgcatcagacctctgcctttcccaacgatctaaaatcagctgaaaagctgatttttttattgaaacaatacaatttcctgataaaacaagctatactaggacaaaaagacagcgagactgggagagtagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG1352 Methylase of chemotaxis methyl-accepting proteins ... can be seen here     ..................................................................................................................