                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-24.70 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGTAACGACTTACCTGTCAAAGATTGCGGGAAATGAACAGGGGTTTGCCGGCGGTA
TGAATTCAATGTTTACAAGTATCGGCAATGTATTCGGGCCTATTATCGGCGGAATGCT
GTTCGATATAGATGTAAACTATCCTTTCTACTTTGCAACGGTCACCTTAGCCATAGGG
ATTGCACTGACCATTGCTTGGAAAGCGCCTGCACATCTTAAAGCCAGCACGTGAtaagaa
gcgcattctttgtgtactgcaaagaatgcgcttcttctttatactgatgatagaaggagtgatggcATG

    bmrR Gene: bmrR     GI: 50812267     BI number: BSU24020     GOG: COG0789,COG4978     Description: transcriptional regulator (MerR family   G        GC T  C      A  A T  T      C  C AT        CG CG        GT CG       A  G A  A      A  A G  A       At TA        Ta CG        Ta |  C       Cg         a |  G       Ta       t  c |  C      |  a      g  t |  C      |  g       tg AT       |  c       gc CG       |  g       ta GC       |  c       ta TA       |  a       ta T  C      |  t       cg A  A      |  t       ta GT       |  c       ta GC       |  t       at GT       |  t       cg AT        At        gc TA        Cg        cg A  A       At        gc C  A       Cg        at CG        Gt        at GC        Ta        gc                         ttctttatactgatgatagaaggagtgatggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here [KT] COG4978 Transcriptional regulator, effector-binding domain/component ... can be seen here     ..................................................................................................................