                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATTGCTACCGAGTGGTCCGTTCTGCTTCGGGACATTTCGAAACAGCAGTTATAAGG
CATGAAGCTGTCCGGTTTTTGCAAAAGTGGCTGTGActgtaaaaagaaatcgaaaaagaccgttttgtgtgaa
aacggtctttttgtttccttttaaccaactgccataaatcgatcctttcttctattgacagaaacaggagagaataatatattctaattgttaacctttg
aatataattggttaacaatttaggtgagaagcgctacacgttcttcagttatcagtgaaagggcgagaaATG

    bioW --- bioA --- bioF --- bioD --- bioB Gene: bioW     GI: 50812281     BI number: BSU30240     GOG: COG1424     Description: 6-carboxyhexanoate-CoA ligase Gene: bioA     GI: 16080075     BI number: BSU30230     GOG: COG0161     Description: adenosylmethionine-8-amino-7-oxononanoate aminotransferase Gene: bioF     GI: 16080074     BI number: BSU30220     GOG: COG0156     Description: 8-amino-7-oxononanoate synthase Gene: bioD     GI: 16080073     BI number: BSU30210     GOG: COG0132     Description: dethiobiotin synthetase Gene: bioB     GI: 16080072     BI number: BSU30200     GOG: COG0502     Description: biotin synthetas TC G  C TG        aa CG       t  a GT       g  a AT        ta AT        cg GT       |  a T  |      |  a AT       |  a CG        At GC        Gc |  A       Tg G  A      |  a A  A      |  a A  A      |  a        g TG       G  a      t  t AT        Ta       g  g TG        Cg        ta TG       |  a       ta GC        Gc        ta AT        Gc        ta CG        Tg        gc |  T      G  |       cg |  G       At        cg |  A       At        at Gc        At        gc At        At        at Cg        Cg        at At        Gt        at                         ttgtttccttttaaccaactgccataaatcgatcctttcttctattgacagaaacaggagagaataatatattctaattgttaacctttgaatataattggttaacaatttaggtgagaagcgctacacgttcttcagttatcagtgaaagggcgagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1424 Pimeloyl-CoA synthetase ... can be seen here [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here [H] COG0156 7-keto-8-aminopelargonate synthetase and related enzymes ... can be seen here [H] COG0132 Dethiobiotin synthetase ... can be seen here [H] COG0502 Biotin synthase and related enzymes ... can be seen here     ..................................................................................................................