Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=63 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GAAAAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAAGGTTGCAGAAACGATATATGAAAATACGATTCAATTTTACCCCGCTATTTT
CCGGAAATTAAGACCCTAAatgattaagatttcactttatttgaagagataggagagtttctcttatctctttttattatggatat
tttttctaatattttctataatttatgatGTG

    BT9727_0199


Gene: BT9727_0199     GI: 49476743     BI number: BT9727_0199     GOG: -------     Description: conserved hypothetical protei


 TT
A  T
A  T       ag
C  A      a  a
T  C      t  t
T  C      t  t
A  C       at
 GC        gc
 CG        ta
|  C      |  c
 AT        at
 TA        At
 AT        At
 AT        Ta
 AT       C  |
 AT       C  |
 GC       C  |
T  |      A  |
A  |       Gt
T  |       At
A  |       At
T  |       Tg
A  |       Ta
 GC       |  a
 CG       |  g
|  G      A  a
A  A      A  g        t
A  A      A  a      g  t
A  A      G  t      a  t
G  T      G  a       gc
A  T       Cg        at
C  A       Cg        gc
G  A       Ta        gt
 TG        Tg        at
 TA        Ta        ta
 GC        Tg        at
 GC        At        gc
                        tctttttattatggatattttttctaatattttctataatttatgatGTG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.50 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=63 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GAAAAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAAGGTTGCAGAAACGATATATGAAAATACGATTCAATTTTACCCCGCTATTTT
CCGGAAATTAAGACCCTAAatgattaagatttcactttatttgaagagataggagagtttctcttatctctttttattatggatat
tttttctaatattttctataatttatgatGTG

    BT9727_0199


Gene: BT9727_0199     GI: 49476743     BI number: BT9727_0199     GOG: -------     Description: conserved hypothetical protei


 tt
t  g
a  a
t  a
 tg
 ta
 cg
|  a
 at
 ca
 tg
 tg
t  |
a  |
g  |
a  |
 aa
 tg
 ta
 ag
 gt         t
|  t      g  t
|        a  t
t         gc
a         at
A         gc
A         gt
T         at
 C        ta
 C        at
 C        gc
 A        at
 G        gc
 A        at
 A        at
            tttattatggatattttttctaatattttctataatttatgatGTG


    ..................................................................................................................