                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCATAACCCGAAGGTCGCAGGTTCAAATCCTGTCCCCGCAACCAAATGGTCCCGT
GGTGTAGTGGTTAACATGCCTGCCTGTCACGCAGGAGATCGCCGGTTCGACCCCGGTC
GGGACCGCCATTTtatataaagaaaagaacgaaacatgttgtttcgtatttttttatttgttttaacaaaaaactaataaagacagtcaaa
ctatccttaggaaaactcctaaggacttttttatatatttaaaacctgtataataaagagcagagaacattgtgagtaaagtaggtgaagtctGTG

    BT9727_0230 --- BT9727_0231 --- rimI --- gcP Gene: BT9727_0230     GI: 49476751     BI number: BT9727_0230     GOG: COG0802     Description: conserved hypothetical protein, uncharacterised P-loop hydrolase Gene: BT9727_0231     GI: 49479117     BI number: BT9727_0231     GOG: COG1214     Description: probable O-sialoglycoprotein endopeptidase (glycoprotease) Gene: rimI     GI: 49479116     BI number: BT9727_0232     GOG: COG0456     Description: ribosomal-protein-alanine N-acetyltransferase Gene: gcP     GI: 49476752     BI number: BT9727_0233     GOG: COG0533,COG3642     Description: O-sialoglycoprotein endopeptidas             A           C  C AA       T  G A  T       GC CG        TA CG        CG AT        CG A  C      |  A C  C      |  G GC       G  A CG       T  T |  T      C  C CG        CG        CC CG        GC       C  G C  T      T  C       CG T  G      A  G       AT GT        CG        GC TA        AT       |  G CG        AT        CG |  T      |  C       TG CG        TG        TA TG        TA        GC AT        GC        GC AT        GC        CG                         CCATTTtatataaagaaaagaacgaaacatgttgtttcgtatttttttatttgttttaacaaaaaactaataaagacagtcaaactatccttaggaaaactcctaaggacttttttatatatttaaaacctgtataataaagagcagagaacattgtgagtaaagtaggtgaagtctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0802 Predicted ATPase or kinase ... can be seen here [O] COG1214 Inactive homolog of metal-dependent proteases, putative molecular chaperone ... can be seen here [R] COG0456 Acetyltransferases ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here [T] COG3642 Mn2+-dependent serine/threonine protein kinase ... can be seen here     ..................................................................................................................