                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:90 nt. Size=72 nt.     Delta G=-24.70 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=59 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaaaatacgttcaagggttaatatgagtatgtaattcaaacgaaaagtgaatattatgccgtcgtataatatcggggatatggcccgaaagtttc
tacctagctaccgtaaatggcttgactacgaggcgtttttataaaggtgaggggaatcttatctttattcatagaacgcttccatgtatgtgcaatggaa
gccttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG

    BT9727_0241 Gene: BT9727_0241     GI: 49476756     BI number: BT9727_0241     GOG: COG2252     Description: guanine-hypoxanthine permease; xanthine/uracil permease family protei            ga           g  a            gt            gc            at            gt            ta ct        gt a  a       gc gc        at tg        at ta        at cg        ta g  g       at gc       |  t tg       |  c at       |  a at       t  t at        ta |  t       tg |  t       ta t  a       ta g  t       gc c  a       cg c  a       gc a  a       gt        tg tg        at       a  t cg        gc        tg gt       c  c       gc a  g      a  a      |  a ta       t  t       ta cg        cg        at cg        at        cg a  |      g  a       cg tg       t  t       ta cg       t  |       ta ta        cg        cg ta        gt        gc                         cttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................