Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.50 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=43 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggcc-tatgtt. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggccgctcatttgcgacttccttatgttaacatcttcatctttcaatgtcaactaagtttttcatttcgtttgtcgcttgcgacgttaatgtcatcag
cgacttttcttatattacacctctatataataatagtcaatattaatctttcatttttttaaaaaagataaaaaagactttcatacctcccttttgtttc
tcataaatatcaataagataaccgaaaggagtgtagaacTTG

    BT9727_0258


Gene: BT9727_0258     GI: 49476770     BI number: BT9727_0258     GOG: -------     Description: conserved hypothetical protei


  c
t  g
t  t
t  t
 at
 cg
t  t
t  c
t  |
t  |       ta
 tg       t  a
 gc        gt
 at        cg
 at        at
 tg        gc
c  c      c  a
a  |      g  t
a  |      t  c
 cg        ta
 ta        cg
 gc        gc
 tg        cg
 at        ta
 at        gc
            ttttcttatattacacctctatataataatagtcaatattaatctttcatttttttaaaaaagataaaaaagactttcatacctcccttttgtttctcataaatatcaataagataaccgaaaggagtgtagaacTTG
    ..................................................................................................................