                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:29 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=77 nt.     Delta G=-23.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tataca-taaaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatacatgcttttgtttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtgagcaaacatcg
accctcaacctgatctggataatgccagcgtagggagttacttaaagtaatgtagcatatgttattctataataacttgcatacaaggctttcctacgtg
gtaggaaagccttttcttattttaaaatttaatttcataagggggattttattATG

    BT9727_0356 --- BT9727_0357 --- BT9727_0358 --- BT9727_0359 Gene: BT9727_0356     GI: 49476804     BI number: BT9727_0356     GOG: COG0011     Description: conserved hypothetical protein Gene: BT9727_0357     GI: 49476908     BI number: BT9727_0357     GOG: COG0600     Description: ABC transporter, permease Gene: BT9727_0358     GI: 49476805     BI number: BT9727_0358     GOG: -------     Description: ABC transporter, substrate-binding protein Gene: BT9727_0359     GI: 49479040     BI number: BT9727_0359     GOG: -------     Description: ABC transporter, ATP-binding protei ta c  t ta ta at ta ta gc t  t a  | t  | at cg gc |  a at ta gc ta a  a a  g tg gc at a  | a  | t  | t  | c  | a  | t  |        t t  |      g  g g  |       cg at        at gt        ta gc        cg gc        cg at        ta ta        ta gc        ta cg        cg g  |       gc at        gc cg        at cg        at             ttcttattttaaaatttaatttcataagggggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................