                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -5.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatagaatataacagaggagtttatactcttaatataacaaatgttaaaggagtgaaaggataaaatgactttatcaactgttcttcaaatggttttagc
ttgatatgggagaagtctgcccatttttatcgattaagctaaattgaagacagcaggtaaagaaccttaatccttttttacgataatatgtaatgggtaa
ggtgtattcaccttacccatttttatgcacaattaaataaggctttatactgttgctctctctatttagcttatgagctataagtaaaggagagaaaata
ATG

    BT9727_0361 Gene: BT9727_0361     GI: 49476807     BI number: BT9727_0361     GOG: COG1245     Description: ABC transporter, ATP-binding protei   a a  g a  a ta gc gc at c  t g  a a  a c  t a  c gc at        aa at       t  t gt       a  a t  |       gt t  |       cg at        at at        ta at        ta ta       t  t       at c  |      t  |      t  t g  |      t  |       gc a  |      t  |       ta a  |       cg        gc t  |       cg        gc t  |       tg        at a  |      a  |       at gc        at        ta cg        ta        gc ta        ta        gc at        cg        gc ta        cg        ta ta        at        at                         ttttatgcacaattaaataaggctttatactgttgctctctctatttagcttatgagctataagtaaaggagagaaaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1245 Predicted ATPase, RNase L inhibitor (RLI) homolog ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.50 kcal/mol Antiterminator: Size=40 nt.     Delta G= -5.60 kcal/mol Anti-antiterminator:   Size=38 nt.     Delta G= -4.92 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aatagaatataacagaggagtttatactcttaatataacaaatgttaaaggagtgaaaggataaaatgactttatcaactgttcttcaaatggttttagc ttgatatgggagaagtctgcccatttttatcgattaagctaaattgaagacagcaggtaaagaaccttaatccttttttacgataatatgtaatgggtaa ggtgtattcaccttacccatttttatgcacaattaaataaggctttatactgttgctctctctatttagcttatgagctataagtaaaggagagaaaata ATG     BT9727_0361 Gene: BT9727_0361     GI: 49476807     BI number: BT9727_0361     GOG: COG1245     Description: ABC transporter, ATP-binding protei            aa   g       c  a t  a      t  t a  c       tg at        cg at       |  t at       t  t ta       t  t at        gt gc        ta |  a       cg g  a      |  c       ag a  c       at       a  t a  t       at        gc a  g       cg        at g  t       ta       |  g t  t       at        gc gc        ta        gc at       t  t       gc gt        tg        ta gc        cg        at                         ttttatcgattaagctaaattgaagacagcaggtaaagaaccttaatccttttttacgataatatgtaatgggtaaggtgtattcaccttacccatttttatgcacaattaaataaggctttatactgttgctctctctatttagcttatgagctataagtaaaggagagaaaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1245 Predicted ATPase, RNase L inhibitor (RLI) homolog ... can be seen here     ..................................................................................................................