Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=61 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:    Distance from promoter:69 nt.    Size=19 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAT-TAAAAA. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAATTGCTTGAATGGATTTAGTAAAAACGGAAGTGTGTATGTCGTTTTATTATCTA
ACATTCAAAACAATATTAAATCGTTTGGTAAAGTGAACAACGACATTTATACGATGTT
GCGAAATATTGAAGTGTAAgagactatccttttgggtagtttttttattgaggaagtgtatgtgcaatgagataatgaaataaatg
gaaaagggggaggggtATG

    BT9727_0417


Gene: BT9727_0417     GI: 49476821     BI number: BT9727_0417     GOG: -------     Description: hypothetical protei


           CG
          G  A
           TA
           TA
           GT
           TA
           AT
           GT
           CG
          A  |
          T  |
          A  |
           TA
           TA
           TG
           AT
           CG
           AT
          G  A
          C  A
          A  g
          A  a
          C  g       tt
          A  |      t  t
  T       A  |       cg
A  A      G  |       cg
T  C       Ta        tg
 TG        Gc        at
 TA        At        ta
 AT       A  a       cg
 CG       A  t       at
 AT       T  |       gt
 GT        Gc        at
 CG        Gc        gt
                        tttattgaggaagtgtatgtgcaatgagataatgaaataaatggaaaagggggaggggtATG


    ..................................................................................................................