Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGCATGTTCCACAGGAATCATTTCTTTTTTCGTATCTTCTTTTGATTCTTCTTTCG
TATTTGATTTTCCACAAGCACTTAAAAGCAGTGAAAAGGCTAATAAAAATACAAATAC
TGTAAACGATTTCTTTCGCATGAAATTCATtatgtaccccctacatagtgagaatttttttcaatagcaagcatgata
ttaagcctttatctttagattgtcaatacatacggttgaaaataattctcatttccgttgacaatgagaattaagttgaaatacacttacaacgtatcat
tatacaTTG

    BT9727_0526 --- fecD --- fecE


Gene: BT9727_0526     GI: 49476844     BI number: BT9727_0526     GOG: COG0609     Description: iron compound ABC transporter, permease
Gene: fecD     GI: 49480208     BI number: BT9727_0527     GOG: COG4779     Description: iron(III) dicitrate ABC transporter, permease
Gene: fecE     GI: 49480209     BI number: BT9727_0528     GOG: COG1120     Description: iron(III) dicitrate ABC transporter, ATP-binding protei


 CA
G  G
A  T
A  G
A  A
A  A
 TA
 TA
 CG
A  |
 CG
 GC        CG
 AT       T  C
A  A      T  A
C  A      T  T
A  T       CG
C  A       TA
C  |       TA         c
 TA        TA       c  c
 TA        AT       c  c
 TA        GT        at
 TA       C  C       ta
 AT       A  A       gc
|  A       AT        ta
 GC        At        at
 TA        Ta        ta
 TA        Gt        Tg
 TA       T  |       At
 AT        Cg        Cg
 TA        At        Ta
 GC        Ta        Tg
                        aatttttttcaatagcaagcatgatattaagcctttatctttagattgtcaatacatacggttgaaaataattctcatttccgttgacaatgagaattaagttgaaatacacttacaacgtatcattatacaTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here
[P] COG4779 ABC-type enterobactin transport system, permease component ... can be seen here
[PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here

    ..................................................................................................................