                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -3.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTATATGTGAAATCGCTTCTTCTCCGGATCGTGCACATATGCAGTTATATCCAATTG
GAGTAAGATAAAGCGTTAATAATTCAAGCATTCTCGGTTCATCGTCTACGAGCAGTAT
ATCAATCATagagaaccctccatctttataatcgttacttaaattgtaagtcaaaatcatgaagaaatggtgcagattataatgcatctgcata
atttcttcagaattacttgttattgtttagttgaacttctactttaggtaatgatattggctcaataaagactaatacggaggcgatataATG

    BT9727_0564 Gene: BT9727_0564     GI: 49476856     BI number: BT9727_0564     GOG: NOG13418     Description: conserved hypothetical protei   t a  t a  g at ta ta cg        ag at       a  a t  c      g  a t  a       ta        aa g  a       at       t  t c  a       cg       a  g t  a       tg       t  c a  t       at        ta a  c      a  g       at ta       a  c       gc at       a  a       at tg        cg        cg ta        ta        gc ta        gt        ta cg        at        gt                         aatttcttcagaattacttgttattgtttagttgaacttctactttaggtaatgatattggctcaataaagactaatacggaggcgatataATG     ..................................................................................................................