                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -4.67 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAATTTTCGTTGGTATTCCGTTAACGTCTAGTATTGCGAATGGAATTGCAATTGGA
TTTTTAGTGTATCCAGTCTTGAAAATTGTGAAAGGGAAAGGAATGGAAGTACATCCGC
TACTCTACTTATTTACAATTTTATTTGGATGTCATTTATTCTTATAAtatagatataggagaggg
ggcttcttatgaggggctccttttttgtgtataataaagtgaaacttaaattagtaacgtaaaatataaattacttattggaatatatatgttacaataa
aggtagaggaggaacatgaATG

    BT9727_0605 --- BT9727_0606 Gene: BT9727_0605     GI: 49476873     BI number: BT9727_0605     GOG: COG1476     Description: transcriptional regulator Gene: BT9727_0606     GI: 49479844     BI number: BT9727_0606     GOG: -------     Description: hypothetical protei             t           a  a           t  g           A  a TT        At A  T       Ta T  A       At T  C       Ta C  A       Tg A  A       Cg T  T       Ta C  T       Tg        at T  T      A  a      t  g C  T      T  g       ta A  A       Tg        cg T  T       Tg        tg C  T      A  |       tg GT        Cg        cg CG        Tg        gc CG        Gc        gt TA       T  t       gc AT        At        gc CG        Gc        gt AT        Gt        at                         ttttgtgtataataaagtgaaacttaaattagtaacgtaaaatataaattacttattggaatatatatgttacaataaaggtagaggaggaacatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1476 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................