                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:49 nt.    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=42 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-12.06 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACA-TATATT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACAGCGATTGTTATTGTTGTTATATTAACGACGATTATTACGCCGCCGCTTTTAA
AGAAATATTTCGTGTAAagaggaagagcttatctgaagtaggtaagctctttttttattggaaaggcaatagtcatgtggcatgaaag
gtttgtaattatggtaaaatctatgtatgtgatatgaaaaggagagggaagtgtTTG

    BT9727_0730 --- BT9727_0731 Gene: BT9727_0730     GI: 49476934     BI number: BT9727_0730     GOG: -------     Description: hypothetical protein Gene: BT9727_0731     GI: 49480271     BI number: BT9727_0731     GOG: COG1737     Description: transcriptional regulator, RpiR famil   A T  T AT TA TA GC TG TA GC TG TA AT |  T |  A |  T T  T TA GC TG T  C A  | GC        TA CG       A  T GC        AT A  |       AT C  |       GC A  |      A  G        a C  |      A  T      a  g T  |      A  G       gt T  |      T  T       ta T  |       TA        cg A  |       TA        tg A  |       Ta        at A  |       Cg        ta A  |      G  a       ta G  |       Cg        cg A  |       Cg        gc A  |      |  a       at A  |      |  a       gc GC       G  g       at CG       C  a       at GC        Cg        gt AT        Gc        gt                         tttattggaaaggcaatagtcatgtggcatgaaaggtttgtaattatggtaaaatctatgtatgtgatatgaaaaggagagggaagtgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1737 Transcriptional regulators ... can be seen here     ..................................................................................................................