Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:141 nt.    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-tttcat. It has a score value of 61.58 and is shown in blue

TTGAAATTAACAACATTATCACcttttcatttgcaaactctctttagtttacttgaagggcgtttgcaggtcaatacagaaggt
tttaccttatcttctttcggtatatccttaacctatacataaaaaaatgaaaaaacaaaaaacgtagccaaaaagctacgtttttctcaggctgtggaga
aagtcttctccacagcctgtttttgtgtctgaacctctttttatgtgtcaacactgataaaaaagaggaaaaggagagattttttATG

    BT9727_0776


Gene: BT9727_0776     GI: 49476950     BI number: BT9727_0776     GOG: COG3666     Description: pXO1-120 homology; transposase for IS66


          gt
         a  c
          at
          at
          gc
          at
          gc
          gc
          ta
          gc
          ta
          cg
          gc
          gc
          at
          cg
            tttttgtgtctgaacctctttttatgtgtcaacactgataaaaaagaggaaaaggagagattttttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG3666 Transposase and inactivated derivatives ... can be seen here

    ..................................................................................................................