Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -8.19 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCGAGTAATGAACAGAAAGATAAATTATTATTTGCAGAAGCTAATGTTATGTAAg
gaagtgccctcgtatgagggctatgcagatggaagatatgctgagattagagcttatgcagaatatacaggtgatcgttttgatgtataggagtctggat
ggtttggtgataaggcagttgggaatgggaccgcgttaagacctgttggaatatgtttcgtgacatatcgttaatttagtgaaaaaagaatccttagaat
tgaggattctttttcgtagtttggtagtatggtaggaaagggGTG

    BT9727_0781


Gene: BT9727_0781     GI: 49476952     BI number: BT9727_0781     GOG: -------     Description: hypothetical protei


            t
          a  g
          t  t
           at
           at
           gc
          |  g
           gt
           tg
           ta
           gc
           ta
          c  t
          c  a
           at
           gc
          |  g
           at
           at
           ta
           ta
           gt
 aa       |  t
g  t      |  t
g  g      |  a
g  g       cg
 tg        gt
 ta        cg
 gc       |  a
a  c      |  a
 cg       c  a       aa
 gc       a  a      g  t
g  g      g  a       at
 at       g  a       tg
 at       g  g       ta
 ta       t  a       cg
a  a      a  a       cg
g  g       at        ta
 ta        gc        at
 gc        gc        at
 gc        gt        gc
                        tttttcgtagtttggtagtatggtaggaaagggGTG


    ..................................................................................................................