                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAGAGATTACTGTTTTTAAATCGGTTGGTTTGGCAGTAGTAGATATTATTGTTGC
GAAGTATTTGTATGAGAAAGCGGTGGAGAGTGGGGTGGGGAATAAGATTGAGTTTTGA
gggactgccttttggtggtctttttttgcatggaattttgtgaagcaagaaaaaatgaatattaatattctaatattcaatagaaagataaaatgtttaa
aatttcaaaataataaattataatatatttagtaaaattaaccaaaatatattttacttattatgtattaaaggggaaatgaaaATG

    BT9727_0801 Gene: BT9727_0801     GI: 49476963     BI number: BT9727_0801     GOG: COG4842     Description: conserved hypothetical protei   G T  A TG AT GT AT AT TG |  A A  g       tt A  g      t  t G  g       cg G  a       cg Gc       g  t Gt       t  g Tg        cg Gc        at Gc        gc Gt        gt Gt        gt             tttttgcatggaattttgtgaagcaagaaaaaatgaatattaatattctaatattcaatagaaagataaaatgtttaaaatttcaaaataataaattataatatatttagtaaaattaaccaaaatatattttacttattatgtattaaaggggaaatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4842 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................