Gene putatively regulated by attenuation in B_thuringiensis_konkukian
Characteristics of the secondary structures
Terminator: Distance from promoter:76 nt. Distance to gene:120 nt. Distance to run of Ts=0 nt. Size=35 nt. Delta G=-11.20 kcal/mol
Antiterminator: Distance from promoter:51 nt. Size=31 nt. Delta G= -4.12 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgtca-gaaatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgtcagaaaatccgatggaaagagaaatttacgcaacatatatgattaacgaatttcaatcgaagtataatgtgaataaagtgttttataaataacatc
aacgtaaaacatgatcttggtactacatcaaaatcatgtttttttatatgcaataaaacaattgattattcttaatcattcgacaagatacaacaattta
agatcatatcttttgctatgataagtaaggaatttacatatcgtgttattgggggataaaaagagATG
BT9727_0817
Gene: BT9727_0817 GI: 49476978 BI number: BT9727_0817 GOG: ------- Description: conserved hypothetical protei
t
c a
c a c
a a ta
a t gt
t c gc
a a ta
a a ta
a c c a
tg ta
at at
ta gc
ta ta
ta at
ta cg
gc at
ta at
gt at
ttttatatgcaataaaacaattgattattcttaatcattcgacaagatacaacaatttaagatcatatcttttgctatgataagtaaggaatttacatatcgtgttattgggggataaaaagagATG
..................................................................................................................