Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=20 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tagtat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgattaaaattgtaaatgggatagtatcagatactccgaaaatttattgaagtcaattttgaagtagatgaaatcatcccctaaatgaatcgtttagag
ggtgattttttgtgatgggatttatctaactaaaacagaaaaggacaaaatctgtccaccttaattcagtataattcgatatataaaataagcgaagata
tattattttaaagctgagttttgacaaattgcttaattcaaattcgatATG

    BT9727_0835


Gene: BT9727_0835     GI: 49476992     BI number: BT9727_0835     GOG: -------     Description: conserved hypothetical protei


 ag
a  t
 gc
 ta
 ta
 at
t  |
t  |                  a
t  |                a  t
a  |                 gc
a  |                 tg
 at                  at
 at                  at
 gt                  at
 cg                  ta
c  a       aa        cg
 ta       a  t      c  a
 cg        gc        cg
 at        ta        cg
 ta        at        tg
a  g       gc        at
g  a      a  c       cg
 at       t  c       ta
 cg        gc        at
 ta        at        at
                        ttttgtgatgggatttatctaactaaaacagaaaaggacaaaatctgtccaccttaattcagtataattcgatatataaaataagcgaagatatattattttaaagctgagttttgacaaattgcttaattcaaattcgatATG


    ..................................................................................................................