                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.67 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATGCAATAGGGAAGTTGAAAAAGTATAAGGAAGAAGAGAAGGATCCGAGTCATTA
TGATGTTCAAGTTACCTTGAAGGAATTTTTCAATGTAATAGAAGAGGTAACGAACTAT
TTTGATACAACTCAAAGTGATATAGAGGACATAATCCCAAAATCAAACCTCCCACTAT
CCGAATTCCCAGCTCTCTTCACAACTGAAGAAGAAAACTATATAAAAGTAGCAATGAA
GCAGTTTAACACCTAGttaaattgctttttcattataatagaagaaaaaccaaacggaggaaacccacATG

    BT9727_0847 Gene: BT9727_0847     GI: 49477004     BI number: BT9727_0847     GOG: COG4997     Description: conserved hypothetical protei            AA           T  A           A  A            TG            AT            TA            CG           A  C           A  A           A  A        C           A  T      C  T AA       G  G      A  A C  C      A  A       CG AT       A  A       At CG       G  G       At TA       A  |       Ta TA       A  |       Ta CG        GC        Ta |  A       TA        Gt TA        CG        At CG        AT        Cg TA        AT        Gc                         tttttcattataatagaagaaaaaccaaacggaggaaacccacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4997 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................