                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taaaaaggagctaactgtatggaacataataaaaatggaatgcttgctttaatcgttttatttgtaggactcgcattttttgttttcggtatggtttatc
atttgtggggaacggtttaaaaataaataataatccatttaagaaaaagtactcgtatgagtactttttttaaaatgtcatgtaaaaacattctaaactt
acttacatgcatacaatcaccaatgatagttatataattgagaaggttgtaaattatcaatctattacaacgtgatttggaaaggagctaaaatctgaaa
ATG

    BT9727_0869 Gene: BT9727_0869     GI: 49477020     BI number: BT9727_0869     GOG: COG4188     Description: carboxylic ester hydrolase; possible acetylhydrolas            aa           a  a            at            ta            ta            ta            gt           g  a           c  a           a  t           a  a           g  a            gt            gc            gc            ta            gt tt       t  t t  a      t  t gt       t  a gc       a  a ta       c  g at       t  | |  t      a  | |  t       ta t  g       ta g  t       ta        ta g  g      g  a      g  t cg       g  a       cg tg        tg        ta tg        at        cg ta        ta        at ta        gc        ta gc       |  t       gc tg        gc        at tg        cg        at                         tttttaaaatgtcatgtaaaaacattctaaacttacttacatgcatacaatcaccaatgatagttatataattgagaaggttgtaaattatcaatctattacaacgtgatttggaaaggagctaaaatctgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4188 Predicted dienelactone hydrolase ... can be seen here     ..................................................................................................................