Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -6.35 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAGTTTAGGATATCCTGATGCAGGTGCGCATGCACTTGGAGTTATCTTTACGGAGA
TTGCCGGTAGTTTGAAATAGgaatgagaaagtccctttgccttaaggtgaaggggcttttatatagttggtagaagactactttc
gggctctctgtaaaatatgagtttgttactatttttgataaaattttatttcaaaaatacaactaatatttctcaatattaatatattgaaaataattag
aatatttaagataatcgtttatgaagaaagaaattataaaaaaagggggaatttattTTG

    BT9727_0890


Gene: BT9727_0890     GI: 49477033     BI number: BT9727_0890     GOG: -------     Description: hypothetical protei


 AT
G  T
A  G
 GC
 GC
 CG
|  G
|  T
|  A
|  G
|  T
|  T
|  T
|  G
|  A
|  A
|  A
|  T
|  A
|  G
|  g
|  a
A  a       ta
T  t      t  a
 Tg        cg
 Ta        cg
 Cg       g  t
 Ta       t  g
A  |       ta
 Ta        ta
 Ta        cg
G  g       cg
 At        cg
 Gc        tg
 Gc        gc
            ttttatatagttggtagaagactactttcgggctctctgtaaaatatgagtttgttactatttttgataaaattttatttcaaaaatacaactaatatttctcaatattaatatattgaaaataattagaatatttaagataatcgtttatgaagaaagaaattataaaaaaagggggaatttattTTG


    ..................................................................................................................