                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:105 nt. Size=28 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: taacct-tataat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taacctttttagacaagttttcatataatgtagtcattcctttcttataaattaagctcgtcacttgaattataaaaatgggattatatcctataacatt
ttcaggaattatccatattttatttctgaaaatgtgctttattttgctgaaaggtggttgcggaaacaaccgcctttttatttatgaaaaatgagatttt
tattaagcttcattacaaagtATG

    BT9727_0899 Gene: BT9727_0899     GI: 49477042     BI number: BT9727_0899     GOG: -------     Description: hypothetical protei   t c  g       ga g  a      g  a ta       c  a ta        gc tg        ta tg        ta at        gc tg        gc tg        tg |  t       gc t  t       gc cg        at gc        at tg        at             ttatttatgaaaaatgagatttttattaagcttcattacaaagtATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.10 kcal/mol Antiterminator: Size=23 nt.     Delta G= -3.20 kcal/mol Anti-antiterminator:   Size=38 nt.     Delta G= -3.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgtatgccaaaacccatttagttttctctgtatctccttgtattgagcaggtagcctttgctagctgctcttttatttgtaacctttttagacaagtttt catataatgtagtcattcctttcttataaattaagctcgtcacttgaattataaaaatgggattatatcctataacattttcaggaattatccatatttt atttctgaaaatgtgctttattttgctgaaaggtggttgcggaaacaaccgcctttttatttatgaaaaatgagatttttattaagcttcattacaaagt ATG     BT9727_0899 Gene: BT9727_0899     GI: 49477042     BI number: BT9727_0899     GOG: -------     Description: hypothetical protei   t t  a a  c c  a ta ta cg gt a  | a  |                 tt t  |        a       c  t tA       t  t       cg aT       g  t       gc tG        tg        at t  t       ta        ta t  |       cg       g  g t  |      c  c       gc ta        ta        at at        cg        cg gc        tg        gc at        at        at gc        ta        gc                         ttttatttgtaacctttttagacaagttttcatataatgtagtcattcctttcttataaattaagctcgtcacttgaattataaaaatgggattatatcctataacattttcaggaattatccatattttatttctgaaaatgtgctttattttgctgaaaggtggttgcggaaacaaccgcctttttatttatgaaaaatgagatttttattaagcttcattacaaagtATG     ..................................................................................................................