Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:181 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.90 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=37 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAGT-TACAGT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAGTTTTTTAGTACGGATTCTTACAGTTGCCAAATGCAATTGCTTATAGAGAATGA
GTGAaaacgcactttagagcatcctcaaagtatgtgaggatgcttttttagcataaaaaaggcatctagcaaaagtactagatgcaaataaaaacac
aagggaagacaaaattcttcccttttcccgtaagtaattatatcaaaaaatttataaaaaactagctttatttttaatataattgatatgtgaagctatg
aaagtataagattacactatttttgtagtgttTTG

    BT9727_0979


Gene: BT9727_0979     GI: 49477076     BI number: BT9727_0979     GOG: -------     Description: hypothetical protei


  A
A  A
C  T
 CG
 GC
 TA
 TA
 GT        Aa
 AT       G  a
 CG        Ta
|  C       Gc
|  T      A  g
|  T       Gc
|  A       Ta         t
|  T      A  |      g  a
A  A      A  |      a  t
 TG        Gc       a  g
 TA        At        at
 CG        Gt        cg
 TA        At        ta
 TA        Ta        cg
 AT       A  |       cg
G  G       Tg        ta
G  A       Ta        at
 CG        Cg        cg
 AT        Gc        gc
 TG        Ta        at
                        tttttagcataaaaaaggcatctagcaaaagtactagatgcaaataaaaacacaagggaagacaaaattcttcccttttcccgtaagtaattatatcaaaaaatttataaaaaactagctttatttttaatataattgatatgtgaagctatgaaagtataagattacactatttttgtagtgttTTG


    ..................................................................................................................