Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-AAGAAT. It has a score value of 71.62 and is shown in blue

TTGAATTTTTAACAGAACTGCCGAAGAATACGACAGGCAAGTTGCTGAGAAGAGCTTT
GAGAGAAAAAGCGATGCAAGTTTAAatataggggcaaccatctttatgaagatggttgcctttctattttttagcattggtt
aagctatggtgccatatatttaaaacgtaatatgactaataaggaggagatataaGTG

    BT9727_1004


Gene: BT9727_1004     GI: 49477086     BI number: BT9727_1004     GOG: -------     Description: hypothetical protei


          at
         t  g
          ta
          ta
          cg
          ta
          at
          cg
          cg
          at
          at
          cg
          gc
          gc
          gt
         |  t
         |  t
          gc
          at
          ta
          at
            tttttagcattggttaagctatggtgccatatatttaaaacgtaatatgactaataaggaggagatataaGTG


    ..................................................................................................................