Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTGCAAAGCGTACGTTCCCAGCAGCAACATATGCAGTATTTACAACGCCGAAAGTT
CCTCATGAAGAAATGGTATCGTCTATTCACCAAACATGGAATGCAGTATTCTCAGAGT
GGTTCCCGCATTCAGGATACGAACATTGCGGCGTTAATGAGTTTGAGCTATACGATGA
GCGTTCCCATGCAGATAAAAGTGAGTTCGCTCAAATTGAACTTTGGATACCGGTGAAG
AAGAAATAAtagattgagagcgagtcattgagaaatggttcgcttttttacaaagggagagtggggatATG

    BT9727_1014


Gene: BT9727_1014     GI: 49477094     BI number: BT9727_1014     GOG: NOG40651     Description: possible Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamil


           CG
          C  G
           AT
           TG
          A  A
          G  A
          G  |
           TG
           TA
           TA
           CG
          |  A
          |  A
          |  A
          |  T
          |  A
          A  A
          A  t
          G  a
           Tg
 AT        Ta
G  A       At
A  A       At
C  A      |  g
G  A      A  a
 TG        Cg        ag
 AT        Ta       g  a
 CG        Cg        ta
C  A       Gc        ta
C  G       Cg        at
T  T       Ta        cg
T  T       Tg       t  g
 GC       G  |      g  t
 CG        At        at
 GC        Gc        gc
 AT        Ta        cg
 GC        Gt        gc
 TA        At        at
                        tttttacaaagggagagtggggatATG


    ..................................................................................................................