Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:42 nt.    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:31 nt. Size=16 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=31 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-taaatt. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgaatactaaatcctgtaataaattaatcctcggttccgatttgtatattgtaccctggtttcagttgaccatttttcatgtggtcttctttcatc
cgcataaagatcgcatctgtatctgttttcgaaaaactatttcttttgataattttgttgtggtgacttaattatatcaaaaaggacgattctttttttt
gtTTG

    BT9727_1025


Gene: BT9727_1025     GI: 49477100     BI number: BT9727_1025     GOG: -------     Description: S-layer protei


 gt
t  a
t  t
 ta
 at
 gt
 cg                   t
c  t                t  c
t  |       ag       t  a
 ta       c  t      t  t
 gc       t  t       tg
 gc        tg        at
c  c       ta        cg
t  t       gc        cg
 cg        gc        at
 cg        ta        gc
                        ttctttcatccgcataaagatcgcatctgtatctgttttcgaaaaactatttcttttgataattttgttgtggtgacttaattatatcaaaaaggacgattcttttttttgtTTG


    ..................................................................................................................