Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:94 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.20 kcal/mol
Antiterminator:    Distance from promoter:33 nt. Size=67 nt.     Delta G=-10.51 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=44 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-tgaaat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcaaataaaacaaaaccattgaaatgaatatttacttttgatgggctacacgaatcgggttcttactgcctgtttgagcgagataaaagaaggatag
gaagatgagaggaggtaggcatgggaatactgaatagaagttcggtatgttctttttctgtgcataaagaaatttcctgtgctaataaATG

    BT9727_0291


Gene: BT9727_0291     GI: 49479061     BI number: BT9727_0291     GOG: COG1597     Description: conserved hypothetical protei


           aa
          g  g
          a  g
          a  a
          a  t
          a  a
          t  g
          a  g
          g  a
          a  a
          g  g
          c  a
  g       g  t
c  g      a  g
 tg       g  a
 at        tg
 at        ta
 gc        tg
c  t      g  g
a  t       ta        ga
c  a       cg       a  a
a  c       cg        tg
t  t       gt        at
 cg        ta        at
 gc        cg        gc
 gc       |  g       tg
 gt       |  c       cg
 tg       |  a       at
 at        at        ta
 gt        tg        at
t  t       tg       |  g
t  |       cg        at
 tg        ta        gt
 ta        ta        gc
 cg        gt        gt
                        ttttctgtgcataaagaaatttcctgtgctaataaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IR] COG1597 Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase ... can be seen here

    ..................................................................................................................