                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:164 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=26 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:121 nt.    Size=38 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT
GATGTAGTTGTTAACGGGATACGTCTGTCCTTTTTTAACAATTGCATAGTAGCTATTG
AACGATAGaaatctcttcacccatttttaataaacgtgtgaaaagggagctatttagcttcctttttctatgccgaaaaccatggggaatgttt
ctttcccatggttttttatattgaaaggagtacggaaaATG

    BT9727_0204 Gene: BT9727_0204     GI: 49479157     BI number: BT9727_0204     GOG: -------     Description: ABC transporter, ATP-binding protei tt a  t ta cg gc                  tt at                 g  t gt        aa       t  c gc       g  a       at gc       c  a       at at       c  c       gt at        gc        gc at        ta        gc at        at        gc gt        tg        ta t  c       cg        at gt       t  g       cg ta       t  g       cg gt        ta        at cg        ta        at                         ttttatattgaaaggagtacggaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=47 nt.     Delta G= -7.00 kcal/mol Anti-antiterminator:    Distance from promoter:44 nt.    Size=58 nt.     Delta G=-10.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT GATGTAGTTGTTAACGGGATACGTCTGTCCTTTTTTAACAATTGCATAGTAGCTATTG AACGATAGaaatctcttcacccatttttaataaacgtgtgaaaagggagctatttagcttcctttttctatgccgaaaaccatggggaatgttt ctttcccatggttttttatattgaaaggagtacggaaaATG     BT9727_0204 Gene: BT9727_0204     GI: 49479157     BI number: BT9727_0204     GOG: -------     Description: ABC transporter, ATP-binding protei AG T  T A  A CG GC T  T TA AT         a AT       t  a CG       t  t A  |       ta A  |       ta T  |       ta T  |      a  c T  |      c  g T  |      c  t TA        cg TA        at C  C       cg CG        ta TA       |  a GT       |  a TA        ta CG        cg        tt Ta        tg       a  t G  a       cg        ta C  |       ta        cg A  |      a  g       gc Ta       a  |       at At       a  |       gt Gc        Gc        gc Gt        At        gc Gc        Ta        at                         ttttctatgccgaaaaccatggggaatgtttctttcccatggttttttatattgaaaggagtacggaaaATG     ..................................................................................................................