Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=47 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=57 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAGA-TATACT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAGAGCGTTCGTAGATTGTTCTATACTGCTTGTACGCGCGCGATGCATGAATTACA
ACTTTATAGCGTTGGCGAGGTTAGTCCTTTTATTGTTGAGGCTGATTCGGAGAGTTTT
GAACTTATTACACCTTGAtaacaatcaaggtgtttcttttttgtgcaggatttacaactttaaagtagaatatatcagtttagaaaa
aagttaaggagcgaaaagATG

    BT9727_0960


Gene: BT9727_0960     GI: 49479801     BI number: BT9727_0960     GOG: -------     Description: hypothetical protei


  A
T  G
T  T
 GC
 GC
 AT
 GT
|  T
|  T
|  A        T
|  T      T  T
|  T      T  G
 CG       G  A
 GT       A  A
 GT        GC
 TG        AT
 TA        GT
G  G      G  A
 CG       C  T
 GC       T  T
 AT       T  A
 TG       A  |
|  A       GC        ac
|  T       TA       a  a
|  T      C  |       ta
|  C       GC        At
|  G       GC        Gc
A  G       AT        Ta
 TA       G  T       Ta
 TG       T  G       Cg
 TA        TA        Cg
 CG        Gt        At
 AT        Ta        Cg
 AT        Ta        At
                        ttcttttttgtgcaggatttacaactttaaagtagaatatatcagtttagaaaaaagttaaggagcgaaaagATG


    ..................................................................................................................