                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAATACAATGCCAGCTGTATTAGCAGAATTAGCATTTGTAGATAATAAGAATGATG
CAAATAAACTCGCTACATCAGCACAGAAACAAAGTGCAGCAGAAGCGATTTATCAAGG
TATTTTAGATTATTACGAAGCAAAAGGTAATAACGTATCTTCTTTCCGTTAAtacatcaaa
agagattgccaataggcagtctcttttatttattaacgtttctctttatttccggcatgtgatatcatttaattttatataagaaagtattgtaattata
acgatatagaggatgatcatagaTTG

    BT9727_0797 Gene: BT9727_0797     GI: 49479832     BI number: BT9727_0797     GOG: COG1041     Description: methyltransferas            AA CA       T  t G  A       Ta A  A       Gc A  A      C  a G  G      C  t CG       T  c AT       T  a TA       T  a TA       C  | AT        Ta TA        Ta        at TA        Cg       a  a A  C       Ta        cg G  |      A  g       cg A  |      T  |       gc T  |      G  |       ta T  |      C  |       tg T  |      A  |       at TG       A  |       gc AT        Ta        at TA        At        gc GT        At        at GC        Tg        at AT        Gc        at AT        Gc        at                         atttattaacgtttctctttatttccggcatgtgatatcatttaattttatataagaaagtattgtaattataacgatatagaggatgatcatagaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1041 Predicted DNA modification methylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.10 kcal/mol Antiterminator: Size=46 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G= -4.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TATAATACAATGCCAGCTGTATTAGCAGAATTAGCATTTGTAGATAATAAGAATGATG CAAATAAACTCGCTACATCAGCACAGAAACAAAGTGCAGCAGAAGCGATTTATCAAGG TATTTTAGATTATTACGAAGCAAAAGGTAATAACGTATCTTCTTTCCGTTAAtacatcaaa agagattgccaataggcagtctcttttatttattaacgtttctctttatttccggcatgtgatatcatttaattttatataagaaagtattgtaattata acgatatagaggatgatcatagaTTG     BT9727_0797 Gene: BT9727_0797     GI: 49479832     BI number: BT9727_0797     GOG: COG1041     Description: methyltransferas            AA AA       T  t G  G       Ta C  C       Gc A  A      C  a T  A      C  t TA       T  c AA       T  a TG       T  a TG       C  | AT        Ta GA        Ta AA        Cg T  T       Ta T  |      A  g T  |      T  | T  |      G  | A  |      C  |       at T  |      A  |      a  a GA       A  |       cg GA        Ta        cg AC        At        gc AG        At        ta CT        Tg        tg TA        Gc        at AT        Gc        gc                         tcttttatttattaacgtttctctttatttccggcatgtgatatcatttaattttatataagaaagtattgtaattataacgatatagaggatgatcatagaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1041 Predicted DNA modification methylase ... can be seen here     ..................................................................................................................