                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:186 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.42 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTAGACAACCGGAAGACATCCCGGCGTTTATTGAAGAATCGTTGCGTATATTGAGA
TAGttattagcggttaatcaaagtagctattttgctactttgattaacctttttatttgtatgaaaaacaaaaaaaatcttatttttaatgatcttgt
cataccccctcttttctctccccaaaacttctaatcacttttcataggcagttctcatatagtgaaaatgactatatgattcctatccataagttaaata
atgattttacaaatatataaatacaaaagatgggagccttatttATG

    BT9727_0750 Gene: BT9727_0750     GI: 49479835     BI number: BT9727_0750     GOG: -------     Description: hypothetical protei            tt   t       a  t t  a      t  t g  a       cg g  t       gc c  c       at g  a       ta a  a       gc ta        at tg        at at        at ta        cg tg        ta Gc        at At        at Ta        ta At        ta Gt        gc             ctttttatttgtatgaaaaacaaaaaaaatcttatttttaatgatcttgtcataccccctcttttctctccccaaaacttctaatcacttttcataggcagttctcatatagtgaaaatgactatatgattcctatccataagttaaataatgattttacaaatatataaatacaaaagatgggagccttatttATG     ..................................................................................................................