                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:161 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=37 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATT-AAAAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATTCAATCTTTTGAAACTGAAAAAATGATTTCAAATTTAGGATAAgatataccgctatctt
cagataaaaggcccttctttacatggaaataaagaagggctttttttattcttatttcctcgttttgcccgtaacctaagaagattaggagtatggtatt
cagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaaaagtgaatgcagctcaaagggcatttgcagttg
aaagaagggagcatatATG

    BT9727_0438 Gene: BT9727_0438     GI: 49479869     BI number: BT9727_0438     GOG: COG3557     Description: conserved hypothetical protei AT A  G A  A AT AT AT GC TA C  A A  A AT AT GT TA T  | T  | TG        tc CG       t  a TA        cg AT        ta A  A       at C  A       ta        gg Tg       |  a      t  a Ta       c  a      a  a At       g  a      c  a |  a       cg        at |  t       cg        ta G  a      a  c       ta T  c      t  c       ta Gc       a  c       cg Tg       t  t       ta Gc        at        ta At        gc        cg Ta        At        cg At        At        cg                         ctttttttattcttatttcctcgttttgcccgtaacctaagaagattaggagtatggtattcagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaaaagtgaatgcagctcaaagggcatttgcagttgaaagaagggagcatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG3557 Uncharacterized domain/protein associated with RNAses G and E ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=37 nt.     Delta G= -4.90 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAGAGCAAACAAATAGTGTGATTCAATCTTTTGAAACTGAAAAAATGATTTCAAA TTTAGGATAAgatataccgctatcttcagataaaaggcccttctttacatggaaataaagaagggctttttttattcttatttcctcgttttg cccgtaacctaagaagattaggagtatggtattcagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaa aagtgaatgcagctcaaagggcatttgcagttgaaagaagggagcatatATG     BT9727_0438 Gene: BT9727_0438     GI: 49479869     BI number: BT9727_0438     GOG: COG3557     Description: conserved hypothetical protei AT A  G A  A AT AT AT GC TA C  A A  A AT AT GT        gc        gg TA       c  t      t  a TG        ca       a  a |  G       at       c  a |  A       tc        at |  T       at        ta TA       |  t       ta TA       t  c       ta Cg       a  a       cg Ta        gg        ta At        Aa        ta A  a      A  t       cg C  t      T  a       cg T  a      A  a       cg T  c      G  a       gc A  |       Ga        gt Gc        Ag        at Tg        Tg        at Gc        Tc        at                         tttattcttatttcctcgttttgcccgtaacctaagaagattaggagtatggtattcagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaaaagtgaatgcagctcaaagggcatttgcagttgaaagaagggagcatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG3557 Uncharacterized domain/protein associated with RNAses G and E ... can be seen here     ..................................................................................................................