                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTATTCCGTTAGAAGCTGTTAAGTATTTCTCGGCAAGCGGTGGTTCACTTGTTACAGC
TTCTATAAGTGAACAGGCAGAATTACCACGAGCGGTTTATTACAGTGTCTCTGCGATA
GTTACAATTAAAAATTAAgagttaaaaaaagatagatgggatgccatctatctttttttattgttagaacatattgtttcgatgaaa
aatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtAT
G

    BT9727_0418 --- BT9727_0419 --- BT9727_0420 --- BT9727_0421 --- galE_lrep_2 --- BT9727_0423 Gene: BT9727_0418     GI: 49479874     BI number: BT9727_0418     GOG: -------     Description: hypothetical protein Gene: BT9727_0419     GI: 49479875     BI number: BT9727_0419     GOG: -------     Description: hypothetical protein Gene: BT9727_0420     GI: 49476822     BI number: BT9727_0420     GOG: -------     Description: glycosyltransferase, involved in cell wall biogenesis Gene: BT9727_0421     GI: 49476823     BI number: BT9727_0421     GOG: COG0677     Description: UDP-glucose/GDP-mannose dehydrogenase family protein Gene: galE_lrep_2     GI: 49480122     BI number: BT9727_0248     GOG: COG0451     Description: UDP-glucose 4-epimerase (NAD-dependent epimerase) Gene: BT9727_0423     GI: 49480124     BI number: BT9727_0423     GOG: -------     Description: glycosyltransferase, involved in cell wall biogenesi            ta           t  a            ga            aa            ga           A  a           A  a            Tg            Ta            At           A  a           A  |            Ag            Aa            Tt            Tg           A  g            Ag        at            Ca       g  g           |  t       gc   T       |  g       gc G  C      A         ta T  T      T         at GC       T         gc AT       G         at CG        A        ta A  C       T        at T  G       A        gc TA        G        at AT        C        at TA        G        at TG        T        at                         tttattgttagaacatattgtttcgatgaaaaatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0677 UDP-N-acetyl-D-mannosaminuronate dehydrogenase ... can be seen here [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here     ..................................................................................................................