Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:157 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-taaaat. It has a score value of 66.93 and is shown in blue

ttaaaacagattgagaggagaaataaaattgatgaaaagagaagaacgcaaaaacatgattgagtttatcgaaaagaaaaaagggattgagcgtgacgaa
ttattatttatgacagatgatgaagtagaacatatttataatgtaacgtactttttatatgaggaaattgcagagtagtataataatccccaccttatta
aaaatataaggtggggattatttcgttattaatacatgagaatgattttcatgtataataatgtaagattggaggaattttactATG

    BT9727_0395


Gene: BT9727_0395     GI: 49479882     BI number: BT9727_0395     GOG: COG2510     Description: permease, drug/metabolite transporter superfamil


           a
         a  a
         a  a
         t  t
          ta
          at
          ta
          ta
          cg
          cg
          at
          cg
          cg
          cg
          cg
          ta
            ttatttcgttattaatacatgagaatgattttcatgtataataatgtaagattggaggaattttactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2510 Predicted membrane protein ... can be seen here

    ..................................................................................................................