                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATATAAAACAAAAATGAATGAGGCGATGTCTTTCTTAGCGAAAGCGAAATCAGTTCG
TGATAAATTGGAACGTATTTATATTGCTGCTATGGATTTTTCGAAAGTAGATGCATAT
AAAGAGGAGATTCAAAAAGAATTTGAACGAATTGCGATTAGTGTAACGGAAAAGAACA
AGTAAaaaataaagaattttggcaagctgtcgggaattttctgacagctattttagtatgtagtaaacttagtaatatatttgtcgaatttccaagg
aaataatcaaaaaatggagagggtatgaaATG

    BT9727_0331 Gene: BT9727_0331     GI: 49479898     BI number: BT9727_0331     GOG: COG3541     Description: conserved hypothetical protei   g a  c a  t        t cg       a  t gt        at gc        gt tg        gc tg        gt tg        cg ta        ta a  a       gc at        ta gt        cg at        gc             tattttagtatgtagtaaacttagtaatatatttgtcgaatttccaaggaaataatcaaaaaatggagagggtatgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3541 Predicted nucleotidyltransferase ... can be seen here     ..................................................................................................................