                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions

GTGAAAAAGTAGATGGAGAAGAGTTAAAAATATCTTTTAGTGCAAAATATATGATGGA
TGCACTAAAGGCATTAGATAGTACTGAAATTAAGATTAGCTTTACTGGAGCAATGAGA
CCATTCTTAATTCGTACGGTAAATGATGAATCCATTATTCAATTAATTTTACCGGTTC
GTACTTACTAAgtaagaaataagggttgctagttttcagatgctagtagcccttatttgatttttgggtattactttcctaatgctagttta
tttagtacaatgaaagaatgaacactttcagaaaGTG

    BT9727_0003 --- recF --- gyrB Gene: BT9727_0003     GI: 49479933     BI number: BT9727_0003     GOG: COG2501     Description: conserved hypothetical protein Gene: recF     GI: 49477032     BI number: BT9727_0004     GOG: COG1195     Description: DNA replication and repair protein Gene: gyrB     GI: 49476686     BI number: BT9727_0005     GOG: COG0187     Description: DNA topoisomerase II, ATP-hydrolyzing (DNA gyrase, subunit B           ca          t  g          t  a          t  t           tg           gc           at           ta           cg           gt           ta           tg           gc           gc           gc             ttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatgaacactttcagaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2501 Uncharacterized conserved protein ... can be seen here [L] COG1195 Recombinational DNA repair ATPase (RecF pathway) ... can be seen here [L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here     ..................................................................................................................