                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.70 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=49 nt.     Delta G= -5.23 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=29 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcac-tacaat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcacgaaaaaaggaaatgaattacaatttaattatctaaaaattttaaattttaaaactgaataattctttatcaagagaggcagagggaccggccct
ttgaagcccagcaacctcagtttatacaaactgaataggtgctaattcctgcaaaatgcattgcattttgaaagataaaacgtaactagtttgtgcaaaa
ctcatctttcttgatcatgaaaggtgagtttttttatatttcaaaacatatacttggaggtatttaaaATG

    BT9727_0329 Gene: BT9727_0329     GI: 49480050     BI number: BT9727_0329     GOG: COG1878     Description: conserved hypothetical protein, possible cyclas            gt           a  t           t  t            cg            at           |  g           a  c           t  a           g  a       at           c  a      g  c   t       a  a      t  a a  t      a  c      t  t cg       a  t       cg gc       a  c       ta ta        ta        ta at        at        ta at        gc        cg at        at        tg at        at        at cg        at        cg g  a       gc        ta t  a      t  t       cg c  a      t  t       at cg        tg        at ta        ta        at                         ttttatatttcaaaacatatacttggaggtatttaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1878 Predicted metal-dependent hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................