                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agctctgttaaatggcagaaaacatttatatcattacgcaacccgtgcggatatatagggcatttttgtcttataaaaagcgtacgttgcgtatatcgta
acgtacgcttttatgcatttttgtgcatatcgtcaagcggcggtatgcttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaa
atgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattaca
TTG

    BT9727_0758 --- BT9727_0759 Gene: BT9727_0758     GI: 49480140     BI number: BT9727_0758     GOG: -------     Description: multidrug ABC transporter, ATP-binding protein and permease Gene: BT9727_0759     GI: 49476945     BI number: BT9727_0759     GOG: -------     Description: multidrug resistance ABC transporter, ATP-binding protein and permeas            ag           a  c            cg tt        tg t  t       gc tg        cg at        tg cg        at gc        ta ta        at at        cg ta        gc             ttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaaatgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattacaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.10 kcal/mol Antiterminator: Size=18 nt.     Delta G= -6.10 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G=-23.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case agctctgttaaatggcagaaaacatttatatcattacgcaacccgtgcggatatatagggcatttttgtcttataaaaagcgtacgttgcgtatatcgta acgtacgcttttatgcatttttgtgcatatcgtcaagcggcggtatgcttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaa atgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattaca TTG     BT9727_0758 --- BT9727_0759 Gene: BT9727_0758     GI: 49480140     BI number: BT9727_0758     GOG: -------     Description: multidrug ABC transporter, ATP-binding protein and permease Gene: BT9727_0759     GI: 49476945     BI number: BT9727_0759     GOG: -------     Description: multidrug resistance ABC transporter, ATP-binding protein and permeas tt t  t at cg gt gc gt at ta at ta |  a a  a t  a a  a g  g gc cg gt ta                  ag gc                 a  c c  |                 cg c  |       cg        tg cg       t  t       gc at        aa        cg at        ta        tg cg        ac        at gc        tg        ta cg        gt        at at        ca        cg ta        gc        gc                         ttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaaatgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattacaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.80 kcal/mol Antiterminator: Size=59 nt.     Delta G=-23.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case agctctgttaaatggcagaaaacatttatatcattacgcaacccgtgcggatatatagggcatttttgtcttataaaaagcgtacgttgcgtatatcgta acgtacgcttttatgcatttttgtgcatatcgtcaagcggcggtatgcttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaa atgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattaca TTG     BT9727_0758 --- BT9727_0759 Gene: BT9727_0758     GI: 49480140     BI number: BT9727_0758     GOG: -------     Description: multidrug ABC transporter, ATP-binding protein and permease Gene: BT9727_0759     GI: 49476945     BI number: BT9727_0759     GOG: -------     Description: multidrug resistance ABC transporter, ATP-binding protein and permeas tt t  t at cg gt gc gt at ta at ta |  a a  a t  a a  a g  g gc         t cg       a  a gt       t  t ta        gc gc        cg c  |       gt c  |       ta cg        ta at        gc at        cg cg        at gc        ta cg        gc at        cg ta        gc             ttttatgcatttttgtgcatatcgtcaagcggcggtatgcttttttttgtttattttccatgttactaaataaaactttggaaggtggaaaaatgtgatgagattgtatgggttacggaatgtaaatgtaatgggtctggatagcggataaagaaatgagagataaaggagaacgagaagggagagattacaTTG     ..................................................................................................................