                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.90 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=42 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:    Distance from promoter:98 nt.    Size=40 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatgt. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaagccctctaaaatattttaatgtgattgtataaaattgtgtatataaaggggagtaacttattacagtaaagtcgtcattacagggagaaaccc
tcggctttattggcaacgtttcgttgttagtgagacctttaccagcaatggtaaaggccccttattgtcttttttaagacccttaccatatttggtaggg
gcctttttgtatacaaagagaggagaaataaaaATG

    BT9727_0720 --- dedA Gene: BT9727_0720     GI: 49480201     BI number: BT9727_0720     GOG: -------     Description: conserved hypothetical protein Gene: dedA     GI: 49481658     BI number: BT9727_0721     GOG: -------     Description: dedA family protein; possible alkaline phosphatase-like protei            tt           t  t            ta            ta            cg ca        ta g  a       gc at       t  | cg       t  | cg       a  | at       t  | ta       t  | ta       c  |       at ta       c  |      t  t cg       c  |       at cg       c  |       cg |  c       gc        cg |  c       gc        at a  c      a  |       ta gc        at        tg at        at        cg gt        ta        cg ta        gc        cg gt        gc       a  c at        ta        gc tg        at        at                         ttttgtatacaaagagaggagaaataaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:101 nt.    Distance to gene:56 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-14.30 kcal/mol Antiterminator:    Distance from promoter:73 nt. Size=35 nt.     Delta G=-13.10 kcal/mol Anti-antiterminator:    Distance from promoter:41 nt.    Size=42 nt.     Delta G=-14.81 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaca-taatgt. It has a score value of 80.32 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacaagccctctaaaatattttaatgtgattgtataaaattgtgtatataaaggggagtaacttattacagtaaagtcgtcattacagggagaaaccc tcggctttattggcaacgtttcgttgttagtgagacctttaccagcaatggtaaaggccccttattgtcttttttaagacccttaccatatttggtaggg gcctttttgtatacaaagagaggagaaataaaaATG     BT9727_0720 --- dedA Gene: BT9727_0720     GI: 49480201     BI number: BT9727_0720     GOG: -------     Description: conserved hypothetical protein Gene: dedA     GI: 49481658     BI number: BT9727_0721     GOG: -------     Description: dedA family protein; possible alkaline phosphatase-like protei   a g  a a  a gc gc gc at c  |        t        ca a  |      t  t      g  a t  |       gc        at t  |       cg        cg a  |       at        cg c  |       at        at t  |       cg        ta gc        gt        ta cg        gt        ta tg        ta        cg gc        tg        cg at        at       |  c at        tg       |  c at        ta       a  c ta       t  g       gc gt       c  a       at at        gc        gt cg        gc        ta                         ttgtcttttttaagacccttaccatatttggtaggggcctttttgtatacaaagagaggagaaataaaaATG     ..................................................................................................................