                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAGATGACCCAACACTTGGACCGTATAATCACGGCTTCCTATTAGGAAGTACGAG
TGATATTTCATTTGAAACACAAGGAGTATTAGATGAGAGATTAGAGATTGTGCAAGAA
AGCGGTCAAGGTCACGGTGGACATTAAtgaaatgagaaaagatgctactaaggtagtgtctttttctttaggaaactttt
acatagcacaaaatcctctactcgttatataataaccttcgtgtagtcggccttgattttcttacggagaaaatcaaatgataaaagagtagaggagtgg
tactTTG

    BT9727_0565 Gene: BT9727_0565     GI: 49480230     BI number: BT9727_0565     GOG: -------     Description: sulfate transporte   t a  g a  a a  g g  a t  a       aa A  a      t  g A  a       cg Tg        at Ta        ta At        cg Cg        gt A  |       tg Gc        at Gt        gc Ta        at Gc        at Gt        at             ttctttaggaaacttttacatagcacaaaatcctctactcgttatataataaccttcgtgtagtcggccttgattttcttacggagaaaatcaaatgataaaagagtagaggagtggtactTTG     ..................................................................................................................