                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.70 kcal/mol
Antiterminator:    Distance from promoter:67 nt. Size=44 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:40 nt.    Size=38 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-TAAAGT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATCAATGGACATCAGTATTAAAGTACATTCCGTTTTATACAGAAGGTGTAGGAT
GGATTGTTCCAGCTATTATAGGTGCTTGTATTGGTGTTATCGTTAGTTTTGTTTTCAA
TAAGAAGAAATAAgtaagaggtgttttcctatttcggaaaacacctttcttttttttggaaaaatagtattgaaaatgaatagactaagag
tatgataaaggtaattggtaatatataggttttgaatgaatgaagaggggggaacgtATG

    BT9727_0601 Gene: BT9727_0601     GI: 49480251     BI number: BT9727_0601     GOG: -------     Description: probable membrane protei             T           A  A           A  A            CG TA        TA G  T       TA T  T       TG TG        TA        tt CG       G  A      a  t G  T      T  A      t  c T  G      T  T       cg GT        TA        cg GT        TA        ta A  A      G  g       ta T  T       At        ta A  C       Ta        ta T  G       Ta        gc T  T      |  g       ta AT       G  a       gc TA        Cg        gc CG        Tg        at GT        At        gt AT        Tg        at                         cttttttttggaaaaatagtattgaaaatgaatagactaagagtatgataaaggtaattggtaatatataggttttgaatgaatgaagaggggggaacgtATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:107 nt.    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.20 kcal/mol Antiterminator:    Distance from promoter:71 nt. Size=44 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:    Distance from promoter:40 nt.    Size=38 nt.     Delta G= -4.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAT-TAAAGT. It has a score value of 69.61 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAATCAATGGACATCAGTATTAAAGTACATTCCGTTTTATACAGAAGGTGTAGGAT GGATTGTTCCAGCTATTATAGGTGCTTGTATTGGTGTTATCGTTAGTTTTGTTTTCAA TAAGAAGAAATAAgtaagaggtgttttcctatttcggaaaacacctttcttttttttggaaaaatagtattgaaaatgaatagactaagag tatgataaaggtaattggtaatatataggttttgaatgaatgaagaggggggaacgtATG     BT9727_0601 Gene: BT9727_0601     GI: 49480251     BI number: BT9727_0601     GOG: -------     Description: probable membrane protei             A           G  A           A  G            AA TA        TA G  T       AA T  T       AT TG        CA CG       T  A G  T      T  g T  G      T  t       tt GT        Ta       a  t GT        Ga       t  c A  A      T  g       cg T  T       Ta        cg A  C       Tg        ta T  G       Tg        ta T  T      |  t       ta AT       G  g       ta TA        At        gc CG        Tt        ta GT        Tt        gc AT        Gt        gc                         tttcttttttttggaaaaatagtattgaaaatgaatagactaagagtatgataaaggtaattggtaatatataggttttgaatgaatgaagaggggggaacgtATG     ..................................................................................................................