                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -5.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAATATGATTATTTGTTAAAGGTCGCAAATCGTGATCGTAAAGAATTAGAGCAGTTT
ATTAGAAAGCTGAATAAGCTTGGTATTACAAAGATACAGACGAGTTTAGCACTTCGTG
AAATTAAATATTCGACGGTATTACCGATACGAAATGAGGAACCGAGCATCGATTAGat
tgcttggttttttgtttgtataaagtgattgacgagaagaaaggagagatgtattattatataaaattatgtattaaaattcattttgggttataaatat
taatatcgggggcaaggggatagcatATG

    BT9727_0740 Gene: BT9727_0740     GI: 49480263     BI number: BT9727_0740     GOG: COG1246     Description: acetyltransferase, GNAT famil   T T  C CG AT        GA CG       C  A |  A      A  A |  A      T  T |  A      A  G |  T      G  A |  T       CG G  A       CG         T A  A      A  A      A  T T  A      T  |      G  A T  T      T  |       CG TA       A  |       Ta GT        TA       |  t AT        GC        At GC        GC        Cg CG        CG        Gc A  A      |  A       At G  C      |  G       Gt A  G      |  C       Cg CG       |  A       Cg AT        AT        At TA        GC        At AT        CG        Gt GT        TA        Gt                         ttgtttgtataaagtgattgacgagaagaaaggagagatgtattattatataaaattatgtattaaaattcattttgggttataaatattaatatcgggggcaaggggatagcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1246 N-acetylglutamate synthase and related acetyltransferases ... can be seen here     ..................................................................................................................