                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:60 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.60 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=40 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATA-TATGCT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATATCCATTATATATTTTGTTTTTTATGCTTTTTGTTCAAATGACAGTTTTTTAT
GTATCATTGTACAGAAATAAGTTAGTCTGAaaagaaaccttcttgcaccggcaagaaggtttcttttcagcttatact
tgtacatacagcaatattatcttatcattttatatagagtaagattttgtaacggaaaggaattgtatATG

    BT9727_0598 Gene: BT9727_0598     GI: 49480293     BI number: BT9727_0598     GOG: COG3764     Description: probable sortase family protei TT        Aa T  T      G  a T  T       Ta G  A       Cg AT        Ta CG       G  | |  T      A  | |  A       Ta AT        Ta GC        Gc TA       A  c       cc AT       A  |      a  g AT       T  |       cg A  G      A  |       gc C  T       At        ta T  |       At        ta TA        Gc        cg GC        At        ta TA       C  |       ta TG        At        cg TA        Tg        cg TA        Gc        at TA        Ta        at                         tcttttcagcttatacttgtacatacagcaatattatcttatcattttatatagagtaagattttgtaacggaaaggaattgtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here     ..................................................................................................................