Gene putatively regulated by attenuation in B_thuringiensis_konkukian

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:169 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagatt-tatgtt. It has a score value of 65.6 and is shown in blue

tagattcaattcaaatctatatatatgttttattttgtatacttatctttctatgctgaaataaaaagatacgactagcgtttgaaaaatttgatatttt
tgctaggtttcttccttatgccaaaatatcaatcatcgttaggtttctttcctatactttcgtattcgaactatatttctagaaatcacgtctcccaaac
cccaaggatattaaaatccttggggttttttgatttttttaggagaggtgaagaaaATG

    ribD --- ribE --- ribA --- ribH


Gene: ribD     GI: 49480339     BI number: BT9727_3851     GOG: COG1985,COG0117     Description: riboflavin biosynthesis protein
Gene: ribE     GI: 49480904     BI number: BT9727_3852     GOG: COG0307     Description: riboflavin synthase alpha subunit
Gene: ribA     GI: 49480905     BI number: BT9727_3853     GOG: COG0807,COG0108     Description: 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II
Gene: ribH     GI: 49480906     BI number: BT9727_3854     GOG: COG0054     Description: riboflavin synthase, beta subuni


          ta
         t  a
         a  a
          ta
          at
          gc
          gc
          at
          at
          cg
          cg
          cg
          cg
          at
            tttttgatttttttaggagaggtgaagaaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here
[H] COG0117 Pyrimidine deaminase ... can be seen here
[H] COG0307 Riboflavin synthase alpha chain ... can be seen here
[H] COG0807 GTP cyclohydrolase II ... can be seen here
[H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here
[H] COG0054 Riboflavin synthase beta-chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Riboflavin_riboswitch sequence ... can be seen here

    ..................................................................................................................