                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAAAGTTGAAGGTGTAACGGTGAACATTAAAAATACTAAAATGATGAAAGATTTTT
TTAAAATGTAAaaaggatctcctttaaggaaatcctttttctcttcatacagcctattaagttctactccttatcattcaaagcaaaactat
taattataacgtttatttacgctgtagttatatacctattgttactattgcagaaaagtacaacaagctggacaacctagatttcaaactgtaagattag
atgttggtgaaatcgggcagcaaagcatatatagaaaataggtgttaattTTG

    BT9727_0905 Gene: BT9727_0905     GI: 49480486     BI number: BT9727_0905     GOG: -------     Description: hypothetical protei AT A  G A  T        t A  A      t  a TA       t  a Ta        cg Ta        cg Ta        ta Tg       c  a Tg        ta Ta        at At        gc Gc        gc At        at             ttttctcttcatacagcctattaagttctactccttatcattcaaagcaaaactattaattataacgtttatttacgctgtagttatatacctattgttactattgcagaaaagtacaacaagctggacaacctagatttcaaactgtaagattagatgttggtgaaatcgggcagcaaagcatatatagaaaataggtgttaattTTG     ..................................................................................................................