                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGATATTAATTTTATAGAAGTCGAAGTATTGGTAGAAGATGTGCAACAAACGTATGAA
AGTTTAAAAGATAATAAAGATGTAAAATGGATTCGCGAACCATTTCCAACAGAATCAG
GACACGTTGCGGTAATGGAAGCACCTGATGAGAATGTGTTTGTGTTGGTAGGAAAATA
Gctgaaatatggagtgacctttcatagtgagttatgaaaggttattttttatgagtggattgttaaatttgtattgctttatctgtaatatatttgaaaa
tggtaaaataaaatagcaattaaataTTG

    BT9727_1015 Gene: BT9727_1015     GI: 49480487     BI number: BT9727_1015     GOG: -------     Description: hypothetical protei   G         g T  A      t  a A  G      c  a G  A      G  a T  A       At C  T       Ta CG        At AT       A  g       ga CG       A  g      t  g GT       A  a       gt AT       G  g       at AT       G  t       ta G  G      A  g       at GT        Ta        cg TG        Gc        ta AT        Gc        ta AT       |  t       ta TG       T  t       cg G  |      T  t       cg G  |       Gc        at CG        Ta        gt GT        Gt        ta TA        Ta        gt TG        Tg        at                         ttttatgagtggattgttaaatttgtattgctttatctgtaatatatttgaaaatggtaaaataaaatagcaattaaataTTG     ..................................................................................................................